Thirty novel genetic variations in the SLC29A1 gene encoding human equilibrative nucleoside transporter 1 (hENT1).

Su Ryang Kim, Yoshiro Saito, Keiko Maekawa, Emiko Sugiyama, Nahoko Kaniwa, Hideki Ueno, Takuji Okusaka, Chigusa Morizane, Noboru Yamamoto, Masafumi Ikeda, Teruhiko Yoshida, Hironobu Minami, Junji Furuse, Hiroshi Ishii, Nagahiro Saijo, Naoyuki Kamatani, Shogo Ozawa, Jun ichi Sawada

Research output: Contribution to journalArticlepeer-review

35 Scopus citations

Abstract

Thirty-nine genetic variations, including thirty novel ones, were found in the human SLC29A1 gene, which encodes equilibrative nucleoside transporter 1, from 256 Japanese cancer patients administered gemcitabine. The found novel variations included -8,166G>A, -81,10A>G, -7,947G>A, -7,789T>C, -5,595G>A, -3,803_-3,783delTCGGGGAGGTGGCAGTGGGCG, -3,548G>C, -3,414G>A, -1355T>C, -34C>G, IVS1+141G>A, IVS1+260C>T, IVS1-82C>T, 177C>G, IVS3-6C>T, 564C>T, IVS8+44T>C, IVS8+90T>C, IVS8+97T>C, IVS8+131C>T, IVS8+169G>A, 933T>C, 954C>T, IVS11-52G>C, IVS11-46G>A, 1,288G>A, 1,641C>G, 1,703_1,704delGT, 1812C>T, and 1861C>T. The frequencies were 0.051 for IVS8+169G>A, 0.012 for -7,947G>A, 0.006 for IVS1+141G>A and 1,703_1,704delGT, 0.004 for -8,166G>A, -8,110A>G, -3,548G>C, -1,355T>C, -34C>G, IVS8+44T>C, and 1,812C>T, and 0.002 for the other 19 variations. Among them, 177C>G and 1,288G>A resulted in amino acid substitutions Asp59Glu and Ala430Thr, respectively. Using the detected polymorphisms, linkage disequilibrium analysis was performed, and 28 haplotypes were identified or inferred. Our findings would provide fundamental and useful information for genotyping SLC29A1 in the Japanese and probably other Asian populations.

Original languageEnglish
Pages (from-to)248-256
Number of pages9
JournalDrug Metabolism and Pharmacokinetics
Volume21
Issue number3
DOIs
StatePublished - Jun 2006
Externally publishedYes

Fingerprint

Dive into the research topics of 'Thirty novel genetic variations in the SLC29A1 gene encoding human equilibrative nucleoside transporter 1 (hENT1).'. Together they form a unique fingerprint.

Cite this